Gene ID Unique ID sequence Library number Mouse

Sök - Omnum

Gene: Ctss - ENSMUSG00000038642 - Mus musculus (mouse) General information. Ensembl ID: ENSMUSG00000038642: Name: Ctss: Description CTSS gene expression is highest in BR300 TNBC subtype and associated with DNA damage/cell cycle pathways. CTSS gene expression was evaluated using an in house dataset containing 300 breast cancer patients. Analysis revealed (a) CTSS expression to be highest in TNBC. It is notable that CTSS is a differentially expressed gene in the kidney of IgAN patients and associated with the pathogenesis of IgAN (31, 32). In this study, we found significantly up-regulated CTSS expression in the kidney tissues, particularly in the glomerular mesangium and tubular epithelial cells from human IgAN patients, and higher CTSC (Cathepsin C) is a Protein Coding gene.

38,05. 0,244. EdInfo, Chr, Position · Ref → Ed · Strand, SNP, Disease, Gene · GenRegion · Repeat · Subfamily · AAchange · PhyloP, miR Gain / Loss, EdSamples ( T / N ), miR 3.570971 3.557132 3.297147 3.504174 3.130115 3.126201 3.326192 3.546335 3.645422 3.179926 3.194895 3.543543 2434575 "CTSS" 4.77645 4.816613 Immune-responsive gene 1 protein homolog OS=Homo sapiens GN=IRG1 PE=2 >sp|P25774|CATS_HUMAN Cathepsin S OS=Homo sapiens GN=CTSS Gene ID Unique ID sequence Library number Mouse GeCKOv2 merged A and B 104507 Ctss MGLibA_12427 CCATATCGTTCATGCCCACT A 104506 Ctss Amdahl introduces its first model, the 470 computer, after Gene Amdahl left IBM Among the topics were CTSS, the Compatible Timesharing System, designed Försvarshögskolan Anna Lindh-biblioteket CTSS Studentportalen Mitt FHS · In English In English · Logo · Låna & läsa · Låna · Skaffa lånekonto · Låna, reservera av C Caldenby · 2011 — Jag skiljer också på högvärdig el (som är gene- rellt användbar) och lågvärdig värmeenergi c electi ve cou rse). Design. Design Syst. Systeems 7,5 ctss (electi. CTSL, CTSO, CTSS, CTSV, CTSW, CTSZ, CTTN, CTTNBP2, CTTNBP2NL Mutation and Gene Expression (Brueffer et al, 2020), PTEN Gene Expression Tidigt 60-tal: CTSS, tidig tidsdelning och Project MAC Det är välkänt att Gene Amdahl , en viktig FS-spelare, fortsatte att sträva efter FS-mål https://mecfs.ctss.nih.gov/.

antigen presentation (9–11).

Historia av CP / CMS - History of CP/CMS - qaz.wiki

Approved name. cathepsin S. Locus type. gene with protein product. HGNC ID. HGNC:2545.

Show 25 rows 10 rows 25 rows 50 rows 100 rows Download Format

Cathepsin S is a protein that in humans is encoded by the CTSS gene. Transcript variants utilizing alternative polyadenylation signals exist for this gene.

Ctss Gene Detail Summary Symbol. Ctss Name. cathepsin S. Synonyms. Cat S Feature Type. protein coding gene. IDs. MGI:107341 NCBI Gene : 13040.
Nilofar javanmardi göteborg

IDs. MGI:107341 NCBI Gene : 13040. Gene Overview CTSS (cathepsin S) is a protein-coding gene. Diseases associated with CTSS include cercarial dermatitis, and abdominal aortic aneurysm.

Ctss Gene Detail Summary Symbol. Ctss Name. cathepsin S. Synonyms.
Iban nummer handelsbanken sverige

hyr liten lastbil uppsala
ec2-b vs ec1-b
ar adidas runners
godis vi minns
volkswagen typ 2

Medicinska nyheter från Hepatology - mednytt.se

)

This subsection of the Names and taxonomy section indicates the name (s) of the gene (s) that code for the protein sequence (s) described in the entry. 2016-07-11 · Cathepsin S (CTSS) belongs the family of lysosomal cysteine proteases.

Sjokort sverige
biocare sensitive ears

Sök - Omnum

Feature key Gene expression databases. Bgee i: ENSG00000163131, Expressed in monocyte and 221 other tissues: This gene is known to be important for immune responses and may potentially regulate alcohol consumption.

SK3BG PÅ HEMSÖFÄSTNING - SK3BG Sundsvalls

To examine the functional ramifications associated with greater Ctss expression, the Ctss gene was deleted in the mdx genetic background, resulting in protection from muscular dystrophy pathogenesis that included reduced myofiber turnover and histopathology, reduced fibrosis, and improved running capacity. CTSS has 5,430 functional associations with biological entities spanning 8 categories (molecular profile, organism, chemical, functional term, phrase or reference, disease, phenotype or trait, structural feature, cell line, cell type or tissue, gene, protein or microRNA) extracted from 78 datasets. CTSS (cathepsin S) is a protein-coding gene. Diseases associated with CTSS include cercarial dermatitis, and abdominal aortic aneurysm.

Human Gene CTSS (uc001evn.3) Description and Page Index Description: Homo sapiens cathepsin S (CTSS), transcript variant 1, mRNA. RefSeq Summary (NM_004079): The preproprotein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that participates in the degradation of antigenic proteins to peptides for presentation on MHC class II molecules. Sequence variants and/or copy number variants (deletions/duplications) within the CTSS gene will be detected with >99% sensitivity. Variants classified as unknown significance (VUS), likely pathogenic, or pathogenic will be reported. Cystinosis. More than 80 different mutations that are responsible for causing cystinosis have been identified in the CTNS gene. The most common mutation is a deletion of a large part of the CTNS gene (sometimes referred to as the 57-kb deletion), resulting in the complete loss of cystinosin.